ABSTRACT CONTENT

Abstract:
An eukaryotic genome contains a sizable portion of repetitive DNA besides single or multiple copies of the transcribing genes. Coding sequences may be present in the close proximity of short tandem repeats (STRs, also known as minisatellites), or may harbour such motifs within themselves. Repeat sequences are known to shrink and expand, fuelling the process of gene conversion and copy number variation involved in diseases and genome evolution. PCR conducted with cDNA template using a single decoy oligo primer based on a consensus of minisatellite sequence amplifies all the tagged sequences called “minisatellite associated sequence amplification (MASA)”. Such transcriptome profile would be specific to the cDNA source having molecular signature corresponding to a tissue or cell type used.

Using several minisatellites such as consensus of 33.15 repeat loci (5’ CACCTCTCCACCTGCC 3’), 33.6 (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), (GATA4/GACA4) or (TGG)5, we conducted MASA reactions with cDNA from different somatic tissues, gonads and spermatozoa of buffalo. The resultant amplicons resolved on the agarose gels were sliced, purified, cloned and sequenced. These sequences were deposited in the GenBank and their accession numbers were obtained. Following this, individual clones were subjected to Blast search against the sequences in the Gen Bank. All the genes showing substantial homologies with our clones were identified. Significantly, each oligo primer generated a unique transcriptome. Of all the genes so identified, some showed highest expression in a given somatic tissue whereas others showed differential expression across the tissues. Further, genes originally isolated from the spermatozoa showed highest expression in testis and spermatozoa. Uniqueness of the transcriptome profile generated by MASA from any tissue is directly related to the type of oligo primer used. Moreover, the tissue specific expression is also indicative of physiological functions of the transcripts.

We also conducted MASA reaction with cDNA from several cell lines including LB27.4 (Hybridoma B-cell), Jurkat (T cell line), Hela, U2OS and 293T. As expected, transcriptome profile from each cell type was unique. Finally, this uniqueness was confirmed using cDNA from tumor tissues. We also studied copy numbers of these genes in different tissues using Real Time PCR. Further, comparative expression profile of these genes across the tissues was monitored using RT-PCR and Real Time PCR. Our results show that MASA approach may be exploited in developing bio-markers from different types of normal and engineered cell lines. We envisage that this technology would be useful in cell and tissue engineering and transplantation biology. Prospects of MASA mediated approach in genome analysis in general and medical biotechnology in particular is highlighted.

Keywords: Repetitive DNA, Genome Analysis, Minisatellite associated sequence amplification (MASA), Biomarkers and Differential Gene Expression
<< Go back to programme page

Markov Chain model for the Indus script

Ronojoy Adhikari
The Institute of Mathematical Sciences
Abstract :
We present an unsupervised approach for learning syntax in undeciphered scripts, using the Indus script as an example. Short-range correlations in the script are effectively captured by a first-order Markov chain. Chain entropies provide a measure of the information content in the script and show a striking match with natural languages.

Pattern Formation in Biology: local self-enhancement and long-ranging inhibition as the driving force

Hans Meinhardt
Max Planck Institute for Developmental Biology, Tubingen, Germany
Abstract :
Development of higher organisms starts with a single cell and leads to an overwhelming complexity of differentiated cells and tissues. This process is, of course, under genetic control. However, the genetic material is the same in all cells. Even after severe perturbations a normal organism can result, showing that development is a self-organizing process. Based on classical perturbation experiments we have proposed molecular realistic interactions that account for basic steps. Pattern formation is possible if non-linear self-enhancing reactions are coupled with antagonistic reactions of longer range. We presume that local self-enhancement and long range inhibition is a universal requirement if pattern formation has to occur in an initially uniform situation. Meanwhile much evidence for this reaction type has been found by molecular-genetic observations. Such interactions lead to instable situations in which minor fluctuations are sufficient to initiate pattern formation. The resulting patterns are very robust. Normal patterns can be restored even after severe perturbation, in agreement with many observations. The emerging local maxima act as signaling centers; cells obtain in this way information about their relative position in the embryo that allows stable activation of the appropriate genetic information. To guaranty a reproducible result of development - a healthy organism - many pattern-forming reactions have to be linked to each other. For instance, it is absolutely essential that the main body axis, head-to-tail and back-to-belly, are oriented perpendicular to each other. Or, to generate a central nervous system such as our spinal cord and backbone, it is crucial that a midline signal is formed that has a long extension in the head-to-tail dimension and a short extension perpendicular to that. In addition, models for the initiation of legs and wings, for the formation of branched vein-like structures and for the orientation of chemotactic cells will be discussed. These models are formulated as coupled partial differential equations that describe the production, spread, decay and the interaction of molecules. By computer simulations I will show that the dynamics of these pattern-forming reactions correspond rather precisely to the observations.

Collective dynamics of coupled cells

Somdatta Sinha
Mathematical Modelling & Computational Biology Group, Centre for Cellular & Molecular Biology, Hyderabad.
Abstract :
Evolution of robust synchronized dynamics is a prerequisite for efficient collective function in cell populations and organised biological systems (e.g. tissues). How the local cellular dynamics and intercellular interactions influence the emergent spatiotemporal behaviour of cell-collectives are important in the understanding of normal and pathological states in biological systems. Using a model system consisting of a ring of coupled cells, we show that, even if the isolated individual cells display complex dynamics as a result of the nonlinear interactions common in cellular processes, intercellular interactions can induce a host of interesting and unusual dynamical features in the ring of cells. Different structural features that can render robustness to the synchronized dynamics will be discussed.

Biotin Self-organization: Making and Machining of Soft Structures and Modification of Human RBCs

S Verma
Department of Chemistry, IIT, Kanpur
Abstract :
Biological superstructures are conventionally generated via recruitment of nanoscopic components in a “bottom-up” approach. In this context, essential biological macromolecules such as proteins, nucleic acids and lipids, have received considerable attention for the construction of self-organized ensembles, owing their potential to form hydrogen bonds and support other non-covalent interactions. We have been working in the area of bioinspired aggregation of peptide/protein conjugates whose sequences are derived from proteins implicated for certain diseases states.1 In this talk, we will present our recent results concerning phased growth of biotin (vitamin H) fibers upon aging, machining of biotin-based soft structures by focused ion/electron beams and morphologies resulting from the interaction of biotin with human red blood cell surface.2 As certain biotin derivatives gain access to Plasmodium falciparum infected erythrocytes and block parasite-induced transport of other solutes, such studies have relevance in understanding biotin-mediated actions on human red blood cells in malarial infections.

Chemistry of the Thyroid Gland: Thyroid Hormones and Antithyroid Drugs

G Mugesh, Gouriprasanna Roy and Debasish Manna
Indian Institute of Science, Bangalore
Abstract :
Thyroxine (T4), the main secretory hormone of the thyroid gland, is produced on thyroglobulin by thyroid peroxidase (TPO)/hydrogen peroxide/iodide system and converted to its active form (T3) by the selenocysteine-containing enzyme iodothyronine deiodinase (ID). The overactivity of TPO and/or ID leads to “hyperthyroidism”, a life-threatening disease, which is treated by antithyroid drugs such as 6-n-propyl-2-thiouracil (PTU) and methimazole (MMI). In view of the current interest in antithyroid drugs and thyroid hormone metabolism, our group is working on the mechanistic aspects of iodination and deiodination reactions. Recent studies show that intermolecular interactions such as halogen bonds play important roles in the activation and inactivation of thyroid hormones. It has been shown that T4 forms short I···O contacts with its transport protein transthyretin and T4 can bind to RNA sequences through halogen bonds. The flavoprotein iodotyrosine deiodinase (IYD), which salvages iodide from mono- and diiodotyrosine formed during the biosynthesis of T4, may utilize halogen bonds for deiodination reactions. In addition to the recognition of thyroid hormones, intermolecular interactions appear to play major roles in the treatment of hyperthyroidism. Recently, significant research effort has been directed to the understanding of the interaction of antithyroid drugs with iodine. These studies provide insight into the nature of products formed during the inhibition of thyroid hormone synthesis. In this lecture, our recent results on the interaction of methimazole and related antithyroid drugs with iodine will be presented.

From Molecule to Crystal: The Problem of Crystal Engineering

Gautam R. Desiraju
Indian Institute of Science, Bangalore
Abstract :
The essential question in crystal engineering is: Given the molecular structure of an organic compound, what is its crystal structure? The difficulty in answering this question lies in that a crystal structure is an emergent property and that it depends on molecular structure in non-obvious ways. The basis of molecular chemistry is the functional group. Molecular functionality is, however, a very poor indicator of supramolecular properties, like crystal structure. Therefore, prediction of a crystal structure requires analysis at a higher level. This higher level is provided by the concept of the supramolecular synthon (S) which is an assembly of molecular functionalities (M1, M2, M3) that conveys kinetic information. A synthon is a structural unit that is found often enough so that one may reasonably predict that an occurrence of say M1, M2 and M3 in a molecule, with or without the simultaneous occurrence of say M4 and M5, will preferentially result in the formation of synthon S1, in preference to say S2 and S3. The concept of the synthon is a simplifying one. One tries to identify certain critical regions of the molecule that will influence and determine the stable crystal structure.

J. Kurths, J. Donges, R. Donner, N. Marwan, Y. Zou PIK

Leiter des Forschungsbereiches Transdisziplinäre Konzepte und Methoden

Abstract :
We consider an inverse problem: Is there a backbone-like structure underlying the climate system? For this we propose a method to reconstruct and analyze a complex network from data generated by a spatio-temporal dynamical system. This technique is then applied to reanalysis and model surface air temperature data. Parameters of this network, as betweenness centrality, uncover relations to global circulation patterns in oceans and atmosphere. We especially study the role of hubs and of long range connections, called teleconnections, in the flows of energy and matter in the climate system. Next, new parameters for the characterization of a network consisting of complex subnetworks are introduced. This concept is applied to pressure data of 17 different heights of the Earth’s atmosphere. The global scale view on climate networks offers promising new perspectives for detecting dynamical structures based on nonlinear physical processes in the climate system.

Pradyut Ghosh

Indian Association for the Cultivation of Science, Kolkata

Abstract :
Sulphates play fundamental roles in many different areas of chemistry, biology and environment. In this talk, anion recognition by synthetic receptors from our group will be briefly presented, along with a detailed description of our recent work on recognition of sulphate by a single molecule capsule.

Self assembly of protein subunits: negotiating the decoy minefield

Debnath Pal
Indian Institute of Science, Bangalore
Abstract :
In the cell, the protein subunits self assemble to form quaternary structure that performs specific biological function(s). This assembly is specific such that the mode of interaction is always same in a given physiological environment. To computationally predict quaternary structure from the structure of the unbound states is a major challenge in molecular biology. A typical work flow to infer such complexes requires initial generation of a large number of putative quaternary structures, which have to be subsequently filtered, structurally refined and ranked based on their similarity to the true quaternary structure. Filtering the putative quaternary structures, also called the “œdecoys”, represent the core bottleneck in the accurate inference of the protein assembly. The difficulty arises due the highly irregular surface geometry of the protein molecules, compounded by the extremely heterogeneous chemical nature of the surface. To address this problem we have developed new measures to quantify the geometric nature of the interacting surfaces to estimate the surface complementarity and the packing of the interacting surface, with a high specificity for the true quaternary structure. We have also discovered that there is a significant correlation between the nonbonding and the desolvation energy during protein binding. Combining these facts we have come up with filtering functions that can discriminate the decoys to identify the true quaternary structure with high accuracy. We expect the work to improve our ability to decipher protein assemblies de novo.

Activation of a complex inactive p53 protein with the aid of small molecule

P. K. Metri, S. Naz, P. Kondaiah, K. R. Prasad
Indian Institute of Science, Bangalore
Abstract :
Activation of mutant p53 protein to active form is of potential importance in treating various cancers. One of the ways to accomplish this is to employ small organic molecules which can bind to the mutant p53 domain and can alter the inactive p53 into the active p53 confirmation. There are very few examples of such small molecule initiated activation of mutant p53. In this lecture, our efforts inspired from the natural product synthesis in identifying a small organic molecule that can transform an inactive p53 to active p 53 form will be discussed.

Ring-opening chemistry of small ring aza-heterocycles: mechanistic investigation and controlled stereoselection

M. K.Ghorai
Indian Institute of Technology, Kanpur
Abstract :
Small ring aza-heterocyles (aziridines and azetidines) serve as versatile intermediates for the construction of important synthetic targets via ring-opening transformations. Recently, Lewis acid (LA) mediated/catalyzed ring-opening of enantiopure 2-aryl-N-tosylazetidines and aziridines by several nucleophiles to provide non-racemic products in high enantio- and diastereomeric excess has been reported by us. We have demonstrated that the LA-catalyzed nucleophilic ring-opening of 2-aryl-N-tosyl-aziridines or azetidines does proceed through an SN2 pathway instead of a stable 1,3- or 1,4-dipolar intermediate. Recent advances of this chemistry in terms of further mechanistic investigations supported by computational studies, controlled enantio- and diastereoselection and important applications in asymmetric organic synthesis will be presented. Under optimum conditions SN2 type ring opening of aziridines and azetidines with appropriate nucleophiles followed by further chemical transformations provide a number of non-racemic targets of immense synthetic and pharmacological interest.

Are Spindle Microtubules Essential for Chromosome Movement During Mitosis?

Imran Siddiqi
Centre for Cellular & Molecular Biology, Hyderabad
Abstract :
Segregation of chromosomes during mitosis requires attachment of the kinetochore to the spindle microtubules. The kinetochore is a specialized structure located at the centromere, a highly condensed and cytologically prominent region of the chromosome. Following capture of spindle microtubules by the kinetochore, chromosomes move towards the pole of the spindle by a process that requires microtubule-based motor proteins that direct polar movement along microtubules. The spindle is considered to be essential for mitotic chromosome movements such as congression towards the centre of the cell followed by migration towards the poles. However recent evidence suggests that some chromosomal movements can occur even in the absence of a spindle. These results and their possible underlying explanations will be discussed.

Phylogenetic Trees and Networks -- Tools for Coping with Evolution and Biodiversity

A. Dress
Shanghai Institutes for Biological Sciences (SIBS), Chinese Academy of Sciences (CAS)
Abstract :
For many years by now, one popular approach to studying complex data sets (e.g., sequence, bio-molecular profiling, time-series, or image data) has been to utilize the information provided by such data sets for constructing a table of distances between the objects of interest to which these data refer, and then to use these distance tables to investigate the internal relationships between those objects. In my lecture, I will report on various aspects of complex data analysis related to this approach (see also the extended abstract and the list of some relevant references sent to the organizers).

Gene networks in theory and practice

Thattai Mukund
Institute of Fundamental Research, Bangalore
Abstract :
I will describe recent developments in the field of synthetic biology, which borrows ideas from engineering to construct genetic networks from standardized parts. I will first mention a few key success stories in which "devices" like amplifiers, flip-flops, and oscillators have been built by inserting a handful of genes into the bacterium E. coli. I'll then present our own work on using engineering principles to design, build and test cell-to-cell communication systems. The design process is very much an art, and failed devices are common – new experimental and theoretical approaches will be required before synthetic biology can mature into a true engineering discipline.

Self-Selection in Coordination Self-Assembly

P. S. Mukherjee

Abstract :
It is difficult to achieve a large desired structure where the controlling forces are weak interactions like hydrogen bonding, van der Waals and - interaction. Instead, by utilizing stronger metal-ligand directional coordination bonding interaction, one can easily prepare desired large molecules using appropriate molecular units. Generally, symmetrical donors are the right choices for designing discrete architectures of defined shapes and sizes. Non-symmetrical/ambidentate linkers are not the preferred choices since they may generate a mixture of several linkage isomeric products. Self-selection of a single linkage isomer using ambidentate linkers in combination with Pt/Pd based acceptors will be discussed. On the other hand, two-component (one donor + one acceptor) self-assembly is a widely used protocol to design large structures. Can multicomponents be assembled to yield a discrete structure selectively without using template? I would address this fundamental question with several examples using a new methodology.

Thermodynamic Principles for Negentropy Build-Up in Self-Organisation

Shripad P. Mahulikar
Indian Institute of Technology, Bombay
Abstract :
Creation & existence of self-organization or dynamic order has puzzled even pioneering scientists, because it “appears” to work against the Entropy Principle (EP). Known thermodynamic principles are conceptually analyzed for deducing 9 statements based on the broken symmetry stated by EP & the Law of Maximum Entropy Production. They serve as scale-invariant guiding principles for creation, existence, & destruction of dynamic ordering, even in biological systems. The concept of negentropy in biology 1st proposed by Schroedinger is re-defined, based on which, scale-invariant physical principles for dynamic order existence (Negentropy Principle) & evolution (Principle of Maximum Negentropy Principle: PMNEP) in chaos are identified. A universal model for dynamic ordering based on mass / energy exchange with the surroundings is introduced, which physically explains Schroedinger’s negentropy debt. The PMNEP encompasses the basic concepts in the evolution postulates by Darwin & de Vries. Perspectives of dynamic order evolution in literature point to the validity of PMNEP as the universal law of evolution. These two additional principles now enable unified explanation of order creation, existence, evolution, & destruction, at all scales; using thermodynamics. Thermodynamic basis is provided for the co-existence of superior & inferior forms of dynamic order in biological systems.
Keywords: autocatakinetic, evolution; negentropy; self-organisation; spontaneous order

Earthquakes as self-organized critical phenomena

V. Gaur
Indian Institute of Astrophysics, Bangalore
Abstract :
Earthquakes are an expression of episodic ruptures or stress relaxation suffered by segments of the earth’s outer brittle rind, the lithosphere, which is of finite strength, and steadily driven by plate tectonic processes. Because of the heterogeneity of the continental lithosphere constituted by long surviving asperities lodged in it by the succession of earth processes as well as the nonlinearity of the stress release mechanism, earthquakes display a rather complex space-time regime, although the rupture planes of the lithosphere or the geological faults have been found to exhibit a fractal distribution suggesting that at large scales, the lithosphere self organizes itself into a critical state. This is indeed consistent with the Gutenberg- Richter1distribution of earthquake sizes that follows a power law, except for the very small events whose record is never too complete, as also the brief post-earthquake temporal regime of aftershocks, first discerned by Omori2 in the late 19th century. Whilst this limited phenomenology of earthquakes predicates the absence of any characteristic scale and therefore of the unpredictability of individual events, there is a widespread belief among seismologists that faults rupture repetitively generating characteristic earthquakes, and the basis of the extant practice for computing probabilistic forecasts. A complete dynamical framework in which the geometrical fractal structure of the fault system and the power laws exhibited by earthquake occurrence, is found to be mutually implicated, however, still remains in being, requiring incisive tests of their fine structure space-time regime, of which an example will be discussed.

Dynamical Processes in the Atmosphere of the Sun

S. S. Hasan
Indian Institute of Astrophysics, Bangalore
Abstract :
The Sun is a low-mass main-sequence star with a convective outer envelope. This layer plays an important role in the dynamics of the solar atmosphere. The convection interacts with the overlying atmosphere through various processes. The primary and dominant way in which this coupling takes place is through the magnetic fields. The structure and dynamics of the magnetic fields continuously change mainly driven by underlying convection. The dynamical evolution of magnetic fields plays a vital role in the heating of the upper atmosphere. Recent high-resolution observations and simulations have shown that the solar atmosphere is shredded by vortex motions at the downdraft regions of convective cells. They not only carry cool plasmas back to convective layer, but also interact with the magnetic fields. The twisting and turning of the magnetic fields due to these vortex motions results in complexities leading to a rich variety of processes in the solar atmosphere. An example is magnetic reconnection which is believed to be important to explain the origin of solar flares. As an illustration, we discuss the "avalanche" model which assumes that the coronal plasma to be in a self-organised critical state.

Relaxed configurations of gravitating systems

Arun Mangalam
Indian Institute of Astrophysics, Bangalore
Abstract :
Galaxies are smooth and relaxed systems but the explanation of this state has eluded normal statistical approaches. I will describe modern statistical approaches to gravity, its importance to gravitational dynamics of galaxies and present a model of violent relaxation.

Complexity in gene promoters and their expression

M. Bansal
Indian Institute of Science, Bangalore
Abstract :
Advances in genome sequencing have led to an avalanche of whole genome sequence data for a multitude of organisms. The big challenge now is a proper decoding of the information contained therein: identification of various genes and parameters determining their expression being one of them. The regulation of gene expression via binding of some specific small proteins (transcription factors) as well as due to nucleoid/chromatin formation has been shown to play an important role and be as important an index of complexity of organisms as the number and nature of genes themselves. Nucleotide sequences located immediately before the transcription start site of a gene usually contain signals for initiating transcription as well as some specific motifs (that serve to regulate gene expression when recognized by the appropriate transcription factors) and are called ‘gene promoters’. Till recently the presence of these sequence motifs and their recognition by the appropriate transcription factors, were considered to be the sole determinants in ‘promoting’ gene expression. However availability of genomic data indicates that very often no strong consensus sequences are present in promoter regions, while some intrinsic structural properties of the DNA are unique and maintained. We have identified three such properties, stability, bendability and curvature in promoter regions to be distinct from other regions of genomic DNA and used them to identify promoters in various organisms, with considerable success. Results from these studies will be presented and correlated with recent experimental evidence from transcriptome analysis.Self-organization and social behaviour in the cellular slime moulds

Self-organization and social behaviour in the cellular slime moulds

Santosh Sathe, Nameeta Mujumdar, Ashwini Dubey, Krithi Nandimath and V. Nanjundiah
Indian Institute of Science, Bangalore
Abstract :
Social behaviour usually involves groups made up of similar units in which what different individuals do is coordinated, apparently towards a common end. Cooperation is one example. More striking instances have to do with so-called altruism, when an individual appears to act in a way that harms its own interests and benefits that of someone else. Beginning with Darwin, biologists have recognised that the existence of ‘altruism’ poses fundamental problems for evolutionary theory. The cellular slime mould (CSM) amoebae are unusual microorganisms that make the transition from solitary to cooperative social life within a single life cycle. Because of this, one can hope to decipher the factors that mediate social behaviour in them, and thereby to gain some insight into the possible evolutionary origins of sociality in general. An analysis of mixed cooperative groups of CSMs shows that inter-individual variability and intercellular communication are two such factors.

The Hydrodynamics of Cumulus Clouds

Roddam Narasimha
Jawaharlal Nehru Centre for Advanced Scientific Research Bangalore
Abstract :
Clouds have enchanted man for millennia; in 1979 Herbert Riehl, a famous American meteorologist, called the cumulus cloud ‘the queen of the tropical sky’. Cloud modelling plays a key role in predicting the monsoons, and has recently been called the ‘big bad player’ in climate change science. So the dynamics of the cumulus cloud continues to pose fundamental scientific challenges. For more than a decade now a group of us at IISc and JNC have been exploring the idea that eventually a cumulus cloud flow has to be understandable as a class of turbulent shear flows, possibly as one whose distinctive characteristic is the internal generation of heat resulting from changes of phase between vapour / liquid / ice in H2O. Dynamical similarity arguments suggest then that a cloud flow can be generated in different fluids provided a non-dimensional heat release parameter lies in the range of values found in a natural cumulus cloud. Based on this argument a special apparatus has been devised in which a jet or plume in a water tank can be subjected to appropriate volumetric heat addition through ohmic dissipation in an electrically conducting liquid. It turns out that many cloud flows, including such types as the cumulus congestus, mediocris and fractus, as well as alto- / strato-cumulus cumulogenitus, can be simulated in the laboratory (the picture above provides an example : natural on left, lab on right). What is more, even the evolution of a cloud and the entrainment anomalies that produce shapes varying from the familiar ‘cauliflower’ to the striking ‘hot tower’ can now be reproduced under controlled conditions and accurately measured using laser-based flow instrumentation. From this body of experimental and supporting computational simulations we propose that cumulus flows constitute a new class of turbulent shear flows best characterized hydrodynamically as transient diabatic plumes.

The hydraulic jump

Rama Govindarajan
Jawaharlal Nehru Centre for Advanced Scientific Research, Bangalore
Abstract :
A hydraulic jump is seen every day in our kitchen sinks. It consists of a sudden increase in height at a certain radial location in a film of water spreading radially outwards. A planar counterpart, the tidal bore, occurs frequently on some rivers. Hydraulic jumps are usually studied using shallow water theory (SWT), which does well in various regimes of the flow. However, we show that SWT cannot describe any film flow when the Froude number is close to unity, i.e., when inertial and gravitational effects are comparable. A different low order equation valid near the jump is derived. Other aspects of the jump will be discussed.

Double diffusive convection in planetary cores

A. Manglik
1.National Geophysical Research Institute (Council of Scientific and Industrial Research), Hyderabad
2. Max-Planck Institute for Solar System Research, GERMANY
Abstract :
Vigorous convection of molten iron in the fluid outer core of terrestrial planets, such as Earth and Mercury, is considered as the main source for the generation and sustenance of magnetic fields of these planets through a dynamo process. The convection is mainly driven by the superadiabatic temperature gradient. In addition, the release of compositionally light material during the solidification of the iron at the inner core boundary contributes to the driving force of convection. The difference in the diffusivities of thermal and compositional components leads to interesting new phenomena that are not found in simple convection, in particular when the variation with depth of one component is stable whereas that of the other is unstable. The situation in which the thermal stratification is stable whereas composition is destabilizing is of particular interest in the context of planetary cores. The presence of such a stable thermal stratification has been inferred for the uppermost 100km of the Earth’s fluid core whereas a large thickness of the Mercury’s fluid core has been inferred to be thermally stably stratified. We analyze the effect of double diffusive convection in such scenarios on the magnetic field generation through three-dimensional numerical solution of the Navier-Stokes equation and two separate transport equations. The results computed for an Ekman number of 3.0x10−4 and diffusivity contrast of ten, composition being slowly diffusing, show significant differences in the magnetic field compared to the corresponding cases driven by thermal convection.

Power law tails in velocity correlations in a non-equilibrium statistical mechanical system

V. Balakrishnan

Abstract :
In contrast to the generic exponential decay of correlations, power-law correlation functions imply interesting statistical correlations, including non-trivial memory effects. A model system, the one-dimensional hard-point gas of equal-mass particles, offers a non-trivial but solvable model in which to examine various effects away from thermal equilibrium. An analytic expression is presented for the one-particle phase-space distribution function in this model. The conditions under which the velocity correlation function can exhibit a power-law tail are elucidated. Exact expressions are given for the diffusion coefficient of a tagged particle, its collision-induced drift velocity, and the rate of energy transfer across it. Some comments are made on the general unequal-mass case.

Contribution to the origin of condensed matter

H. W. Roesky

Abstract :
Contribution to the origin of condensed matter Herbert W. Roesky, University of Goettingen, Institute of Inorganic Chemistry, Tammannstrasse 4, 37077 Goettingen, Germany About 180 molecules in the interstellar space are spectroscopically well characterized. Recently we became interested in synthesising those systems in the laboratory. The general characteristic of these compounds is that they contain elements in formal low oxidation states, and they are unstable at room temperature. For further reactions these compounds have to be stabilized so that they can be handled smoothly at room temperature. Easy access to base stabilized compounds of composition LSiCl2 (L = Lewis base), RSiCl, RSiSiR, and RSiR’ will be reported. Moreover, reactions of alkynes, ketones, carbodiimides, metal fragments, and Lewis acids respectively with these species and the resulting products will be discussed in detail.

Structural insight into the modular organisation

U. Heinemann

Abstract :
Eukaryotic cells are subdivided into separate membrane-enclosed compartments, and every molecule fulfills its biological function inside one of these compartments (organelles) unless it is secreted from the cell. The trafficking of molecules between cellular compartments uses vesicles, small transport containers generated at the membrane of the donor compartment which fuse with the acceptor compartment to release their cargo. Vesicular transport is organized into functional modules: Each transport step is carried out by a distinct set of functionally conserved, but physically distinct proteins. We focus on vesicular transport between the endoplasmic reticulum and the Golgi apparatus. In particular, we study the structural basis of vesicle tethering at the Golgi membrane. This is the step in which the target membrane is recognized by the vesicle, and a first physical contact between vesicle and target membrane is established. The contact is mediated by three classes of proteins, small guanine nucleotide-binding proteins of the Rab/Ypt family, heteromultimeric tethering factors and proteins containing extended coiled-coil regions. Crystal structure analyses of subunits and sub-complexes of TRAPP have revealed how this tethering complex is organized and suggested how it attaches to the Golgi membrane and serves as guanine nucleotide exchange factor for the GTPase Rab1. The role of the coiled-coil golgin p115 in vesicle tethering to the Golgi was studied as well. This work is beginning to reveal the structural basis of the tethering sub-module of vesicular transport.

Planetary Dynamos

U Christensen
Max-Planck-Institute for Solar System Research, Germany
Abstract :
The dynamo process that generates the magnetic fields in the fluid cores of the Earth and other planets is modeled by convection-driven flow and magnetic induction in a rotating and electrically conducting sphere. Several control parameters are far from Earth values, but some models reproduce the observed properties of the Earth’s field, including the dominance of the axial dipole and reversals of its polarity. Dipole reversals are only found near the transition between dynamos with a stable dipolar field and dynamos with complex multipolar field geometry. The transition is associated with a growing influence of inertial forces on the flow. In rapidly rotating spheres inertial effects can drive a large-scale axisymmetric zonal flow. The dipolar poloidal field is intertwined with an (invisible) toroidal field. Toroidal field can be generated in various ways; the shearing of magnetic field lines in the axisymmetric flow (Omega-effect) is one such mechanism. The zonal flow differs in pattern and amplitude between multipolar and dipolar dynamos. A dipolar field suppresses the inertially driven zonal flow. Artificially enhancing the zonal flow forces a transition of an intrinsically dipolar dynamo to the multipolar regime; suppressing it turns a multipolar dynamo into a dipolar one. Close inspection shows that the zonal flow causes an anti-Omega-effect that destroys the toroidal field associated with a dipolar dynamo. Hence geomagnetic reversals may be understood as instabilities associated with the mutual interaction of zonal flow and magnetic field in the Earth’s core.

Complex dynamics with threshold: SOC, generalized epidemic and percolation processes

P. Blanchard
Bielefeld University
Abstract :
We review the theory of inhomogeneous random graph models, Cameo graphs (Blanchard-Krüger 2004) and BJR graphs (Bollobas-Janson-Riordan 2005) and the generalized epidemic process (GEP) formalism including local dynamics and global mean field dynamics and discuss their main properties: phase transitions, connection to threshold percolation, communication index and all that. We introduce different GEP models to describe the spreading of different social processes and "diseases" like corruption, knowledge, innovation, opinion, terrorism etc.

STDP driven self-organization of neuronal network

Quansheng Ren, Kiran M. Kolwankar, Areejit Samal1 and Juergen Jost
1. Max Planck Institute for Mathematics in the Sciences, Germany
2. Ramniranjan Jhunjhunwala College, Mumbai
Abstract :
We study the self-organization of network structure in coupled non-linear oscillators as a consequence of learning dynamics. First, a coupled non-linear maps system is considered and a discrete learning dynamics based on spike time dependent plasticity (STDP). A robust final network with broad degree distribution is obtained. Then we consider the dynamics of the structure of a formal neural network with realistic learning dynamics. For properly chosen input signals, there exists a steady state with a residual network. We compare the motif profile of such a network with that of a real neural network of C. elegans and identify robust qualitative similarities.

Phase Transitions towards Self-Organized Criticality in Neuronal Systems

T. Geisel
Max-Planck-Institute for Dynamics and Self-Organization, Germany
Abstract :
In recent work we have demonstrated the existence of genuine self-organized criticality (SOC) in neuronal networks [1] caused by depressing dynamical synapses, i.e., where the synaptic coupling exhibits fatigue under repeated presynaptic firing. This adaptation mechanism drives the network into a self-organized critical regime by adjusting the average coupling strengths to a critical value. The size distribution of critical avalanches exhibits an inverse power law, which has been observed in the same form experimentally in neuronal cultures as well as in awake monkeys. We have now generalized this study to include facilitating besides depressing synaptic dynamics as found in biological systems. We show analytically that the generalized model attains SOC in an extended region of parameter space that is reached through phase transitions. The critical region of the connectivity parameter is sandwiched between a sub- and a supercritical regime which also can be reached experimentally by a manipulation of the synaptic strengths. The system exhibits a rich dynamical behaviour including a hysteresis between critical and noncritical dynamics, switching of the dynamics in dependence of external inputs, and first- and second-order phase transitions that form a cusp bifurcation [2]. This is the first observation of a complex classical bifurcation scenario combined with a SOC phase.
*work in collaboration with A. Levina and M. Herrmann
References:
[1] A. Levina, J. M. Herrmann, and T. Geisel, Dynamical Synapses Causing Self-Organized Criticality in Neural Networks, Nature Physics 3, 857 (2007).
[2] A. Levina, J. M. Herrmann, and T. Geisel, Phase Transitions towards Criticality in a Neural System with Adaptive Interactions, Phys. Rev. Lett. 102,118110 (2009).

1/f noise as a probe of organization in networked liquids

R. Ramaswamy
Jawaharlal Nehru University, New Delhi
Abstract :
The Raman spectrum of liquid water has a distinctive 1/f dependence which is indicative of long-range temporal correlations in the dynamics. We study bulk water through molecular dynamics simulations and show that the hydrogen--bond network undergoes a multiplicity of relaxation processes. The variations in molecular mobility that are associated with the well--known diffusional anomaly of supercooled water are mirrored in the scaling exponents of the 1/f spectral regime. Experimental studies of the temperature/density dependence of 1/f behaviour can provide a sensitive probe of the microscopic diffusion.

Modeling properties of protein-solvent systems

Juergen Pleiss
Institute of Technical Biochemistry, University of Stuttgart, Germany
Abstract :
Solvents have a major impact to the biophysical and biochemical properties of enzymes. Although aqueous mixtures or biphasic systems of organic solvents are widely used in biocatalysis to stabilize enzymes, to improve solubility of substrates or products, or to tune the selectivity of the catalyzed reaction, in most cases the observed effects can only be described empirically, and a quantitative molecular model of the mechanism is lacking. To investigate the microscopic and macroscopic properties of protein solutions, we have applied large-scale molecular dynamics simulations. In a first step, pure organic solvents were studied, and the force field was fine-tuned to quantitatively predict macroscopic and microscopic properties such as density and self-diffusion coefficient. For aqueous mixtures, experimentally observed deviations from the behaviour of ideal mixtures were reproduced. In a second step, the binding of water to proteins was studied. In gas phase, water binds preferably to a small number of high-affinity water binding sites. Thus, protein-bound water is an integral constituent of proteins that determine structure and flexibility. In a third step, proteins in pure solvents, solvent mixtures, and in biphasic systems were studied, and the effect of solvent to protein structure and flexibility, solvent-induced conformational transitions, and the binding of the protein to interfaces were investigated. Using large-scale molecular dynamics simulations, experimentally determined properties of complex solvent mixtures and of enzymes in solution were reproduced. A quantitative mechanistic description of the interplay between protein and solvents is prerequisite for successfully designing protein-solvent systems with improved properties.

A link between theoretical chemistry and astronomy

S. Ghanta, V. Sivaranjana Reddy and S. Mahapatra*
School of Chemistry, University of Hyderabad Hyderabad-500046.
Abstract :
Identification of molecular carriers of diffused interstellar bands (DIBs) is of immense current concern to unravel the long-standing debate in astronomical observations. Recent telescopic measurements in the line of sight of star Cernis 52 in the Perseus Constellation led to the discovery of new interstellar bands [1,2]. Aided by the laboratory measurements under the exotic condition of interstellar medium, these interstellar features have been "tentatively" assigned to electronic transitions in naphthalene and anthracene radical cation [3, 4]. We report a benchmark theoretical study from first principles and unambiguously validate these assignments [5, 6]. This study establishes that polycyclic aromatic hydrocarbons can indeed be
the molecular carrier of DIBs and ultrafast nonradiative deactivation of their excited electronic states make them photostable [7] against strong UV irradiation in the interstellar medium.
References:
[1.] Iglesias-Groth S, et al., Astrophys. J. 685, L55 (2008).
[2.] Iglesias-Groth S, et al., Mon. Not. R. Astron. Soc., 407, 2157 (2010).
[3.] Biennier L., Salama F., and Allamandola L. J., J. Chem. Phys., 118, 7863 (2003).
[4.] Sukhorukov O. et al., Chem. Phys. Lett., 386, 259 (2004).
[5.] Reddy V. S., Ghanta S., and Mahapatra S., Phys. Rev. Lett. 104, 111102 (2010).
[6.] Ghanta S., Reddy V. S., and Mahapatra S., Communicated
[7.] Reddy V. S. and Mahapatra S., J. Chem. Phys. 128, 091104 (2008).

Studies on the regulation of and by miRNAs

Sanghamitra Bandyopadhyay
Indian Statistical Institute, Kolkata
Abstract :
MiRNAs are ~22nt non-coding RNAs that have been found to regulate the stability and translation of messenger RNAs (mRNAs) through the action of RNA-induced silencing complex (RISC). It is well established that miRNAs regulate the expression of their target mRNAs post-transcriptionally, either through mRNA degradation or translational repression. Recent studies indicate that miRNAs themselves are regulated in much the same way that genes are, through one or more transcription factors. It is also gradually becoming apparent that a complex regulatory network exists at the system level between genes, proteins and microRNAs (miRNAs). It is imperative to study this complex regulatory network in order to better understand the working mechanisms at the cellular level. In this talk, we will describe our current work on studying the role of miRNAs in the regulatory network of the cell. In particular, a putative TF-miRNA-TF regulatory network will be presented. Some ongoing efforts on computational methods to identify TFs that regulate a miRNA, and TFs that are regulated by a miRNA will be mentioned. Finally, some directions for analyzing the TF-miRNA-TF network in order to make interesting biological observations will be stated.

Complexity, Emergence and the Mind

R. Kasturirangan
National Institute of Advanced Study, Bangalore
Abstract :
Complex systems in the physical world often exhibit 'simple' behaviour at the microscopic and macroscopic scales; complexity often arises in the transition from the microscopic to the macroscopic. Newtons laws of motion are simple, and so are the laws of quantum mechanics, but much complexity is involved in going from one to the other. The complex transition from simplicity to simplicity is one of the reasons why theories such as SOC have to be invented to explain simplicity amidst complexity. The laws of the mind are no exception. The rules of reasoning, such as the law of non-contradiction are simple. The behaviour of single neurons is also relatively simple. However, the transition from neurons to mind is doubly puzzling. For one, we are interested in understanding how the simple rules of reason and other mental transformations emerge from complex neural interactions. We also have to explain how entities that obey the rules of logic emerge from entities that obey the rules of physics. I believe these problems are conceptual rather than technical and their solution requires a combination of philosophical and theoretical (in the sense of theoretical physics) thinking. This talk will present some ideas towards that goal.

Patterns in sequences: biology, language, music

Rahul Siddharthan
The Institute of Mathematical Sciences, Chennai
Abstract :
Sequences of discrete symbols pervade science, and techniques to deal with them are of wide interest. Here we discuss biological sequences, languages, and music, all of which are widely modelled as Markov chains, but in fact have longer-ranged correlations which cannot be tractably handled by Markov models. We discuss ways to treat these correlations, and their consequences.

Common Sense, Reason and Rationality in Politics - Order versus System

B. Subramanian
Centre of German Studies, Jawaharlal Nehru University, New Delhi
Abstract :
In the trajectory from tradition to modernity, the framework of values may be comprehended as a movement from the mythological to the rational, from the presumptive to the demonstrable, from implicit faith to explicit proof. Yet, political philosophy in its search for the right order of public life, has to go beyond the rational. The paper seeks to highlight the work of Eric Voegelin, one of the leading political philosophers of the last century, in understanding the nature of order and the limits of rationalism in politics.